s mitis atcc 49456 Search Results


99
ATCC s mitis atcc 49456
S Mitis Atcc 49456, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+mitis+atcc+49456/pmc12014262-140-19-21?v=ATCC
Average 99 stars, based on 1 article reviews
s mitis atcc 49456 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
ATCC oral pathogens
Oral Pathogens, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+mitis+atcc+49456/pm23578062-7-30-34?v=ATCC
Average 99 stars, based on 1 article reviews
oral pathogens - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

94
ATCC phosphoglucomutase gene
Bacterial strains and primers used in the study
Phosphoglucomutase Gene, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+mitis+atcc+49456/pmc03318478-215-70-81?v=ATCC
Average 94 stars, based on 1 article reviews
phosphoglucomutase gene - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

96
ATCC s mitis
Bacterial strains and primers used in the study
S Mitis, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+mitis+atcc+49456/10__1590_slash_s1516___05722014000100020-267-64-66?v=ATCC
Average 96 stars, based on 1 article reviews
s mitis - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

97
ATCC s mutans monoculture
Bacterial strains and primers used in the study
S Mutans Monoculture, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+mitis+atcc+49456/pm39998256-66-14-59?v=ATCC
Average 97 stars, based on 1 article reviews
s mutans monoculture - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

96
ATCC cell abundances
Bar chart of relative <t>abundances</t> of ASVs classified on genus level. Taxa with relative abundance of less than 1% were collectively summarized as ‘Other’. (A) Taxonomic composition of the slit lamp bacteriota from TC1 (Tertiary Center) and TC2 respectively and the respective sample sites (contact area – TC1: n = 28; ocular – TC1: n = 28; contact area - TC2: n = 14; ocular – TC2: n = 13). (B) Composition of mock taxa and controls (expected = expected mock abundances; mock = mock standard using Bact-0341f/Bact-0785r primers; blank = blank negative control).
Cell Abundances, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+mitis+atcc+49456/pmc08635730-45-13-18?v=ATCC
Average 96 stars, based on 1 article reviews
cell abundances - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

99
ATCC 19615 s mutans atcc 25175 s mitis atcc 49456 st aureus atcc 29213 k pneumoniae atcc 4352 c albicans atcc 10231 f1b 2
Bar chart of relative <t>abundances</t> of ASVs classified on genus level. Taxa with relative abundance of less than 1% were collectively summarized as ‘Other’. (A) Taxonomic composition of the slit lamp bacteriota from TC1 (Tertiary Center) and TC2 respectively and the respective sample sites (contact area – TC1: n = 28; ocular – TC1: n = 28; contact area - TC2: n = 14; ocular – TC2: n = 13). (B) Composition of mock taxa and controls (expected = expected mock abundances; mock = mock standard using Bact-0341f/Bact-0785r primers; blank = blank negative control).
19615 S Mutans Atcc 25175 S Mitis Atcc 49456 St Aureus Atcc 29213 K Pneumoniae Atcc 4352 C Albicans Atcc 10231 F1b 2, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+mitis+atcc+49456/ppr0786613-189-5-8?v=ATCC
Average 99 stars, based on 1 article reviews
19615 s mutans atcc 25175 s mitis atcc 49456 st aureus atcc 29213 k pneumoniae atcc 4352 c albicans atcc 10231 f1b 2 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

93
ATCC s mitis type strain ccug 31611
Bar chart of relative <t>abundances</t> of ASVs classified on genus level. Taxa with relative abundance of less than 1% were collectively summarized as ‘Other’. (A) Taxonomic composition of the slit lamp bacteriota from TC1 (Tertiary Center) and TC2 respectively and the respective sample sites (contact area – TC1: n = 28; ocular – TC1: n = 28; contact area - TC2: n = 14; ocular – TC2: n = 13). (B) Composition of mock taxa and controls (expected = expected mock abundances; mock = mock standard using Bact-0341f/Bact-0785r primers; blank = blank negative control).
S Mitis Type Strain Ccug 31611, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+mitis+atcc+49456/pm37951305-34-30-42?v=ATCC
Average 93 stars, based on 1 article reviews
s mitis type strain ccug 31611 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

92
ATCC s anginosus nctc 10713 s anginosus dp s mutans atcc 25175 s sanguinis atcc 10556 s gordonii atcc 10558 s mitis atcc 49456
Bar chart of relative <t>abundances</t> of ASVs classified on genus level. Taxa with relative abundance of less than 1% were collectively summarized as ‘Other’. (A) Taxonomic composition of the slit lamp bacteriota from TC1 (Tertiary Center) and TC2 respectively and the respective sample sites (contact area – TC1: n = 28; ocular – TC1: n = 28; contact area - TC2: n = 14; ocular – TC2: n = 13). (B) Composition of mock taxa and controls (expected = expected mock abundances; mock = mock standard using Bact-0341f/Bact-0785r primers; blank = blank negative control).
S Anginosus Nctc 10713 S Anginosus Dp S Mutans Atcc 25175 S Sanguinis Atcc 10556 S Gordonii Atcc 10558 S Mitis Atcc 49456, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+mitis+atcc+49456/pm29669961-123-24-33?v=ATCC
Average 92 stars, based on 1 article reviews
s anginosus nctc 10713 s anginosus dp s mutans atcc 25175 s sanguinis atcc 10556 s gordonii atcc 10558 s mitis atcc 49456 - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

96
ATCC streptococcus spp
Bar chart of relative <t>abundances</t> of ASVs classified on genus level. Taxa with relative abundance of less than 1% were collectively summarized as ‘Other’. (A) Taxonomic composition of the slit lamp bacteriota from TC1 (Tertiary Center) and TC2 respectively and the respective sample sites (contact area – TC1: n = 28; ocular – TC1: n = 28; contact area - TC2: n = 14; ocular – TC2: n = 13). (B) Composition of mock taxa and controls (expected = expected mock abundances; mock = mock standard using Bact-0341f/Bact-0785r primers; blank = blank negative control).
Streptococcus Spp, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+mitis+atcc+49456/chalmers_natalia_i__2008__multispecies_oral_biofilms_studied_at_the_single_community_level_as_a_model_system_for_spatiotemporal-1171-6-16?v=ATCC
Average 96 stars, based on 1 article reviews
streptococcus spp - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

93
ATCC oral streptococci
A Strain of S. mitis inhibits S. mutans biofilm formation. ( A ) Representative image of a CV biofilm biomass assay where S. mutans is cocultured with different oral <t>streptococci</t> species (listed down right y -axis) in TYGS medium. S. mutans monoculture is shown at the top for reference. ( B ) CV quantification (Abs 575 nm) of the experiment shown in A. Data are expressed as the percentage of biomass formed in comparison to S. mutans monoculture (i.e., monoculture values set to 100%). B’ is same data on a smaller y -axis with S. cristatus and S. sobrinus coculture data removed. n = 6. ( C ) Merged representative maximum intensity 40× Z-projection of 24 h S . mutans monoculture biofilm (Mono). S. mutans constitutively expresses green fluorescent protein (GFP; green), eDNA was probed with labeled antibodies (yellow), and glucans were visualized with labeled dextran (red). Scale bar (100 µm) is shown in the bottom right corner. ( D ) Merged representative maximum intensity 40× Z-projection of 24 h S . mutans cocultured biofilm with S. mitis (+ S. mitis ). ( E ) Quantification of individual S. mutans microcolony volumes, ( F ) number of S. mutans microcolonies per field of view, ( G ) glucan biomass, and ( H ) eDNA biomass from the microscopy data shown in C and D. n = 4. Light gray bars represent S. mutans monoculture, and darker gray bars indicate coculture with S. mitis . Quantification was completed using Gen5 Image+ software. ( I ) S. mutans colony forming units (CFUs) returned from 24 h biofilms, with enumeration of cells in either biofilm (blue circles) or planktonic growth phase (green squares), grown with or without S. mitis . n = 4. ( J ) S. mitis CFUs returned. Data graphing and two-way analysis of variance with multiple comparisons or Student’s t -test were completed in GraphPad Prism software.
Oral Streptococci, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+mitis+atcc+49456/pmc11921374-30-22-31?v=ATCC
Average 93 stars, based on 1 article reviews
oral streptococci - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


Bacterial strains and primers used in the study

Journal: Journal of Bacteriology

Article Title: Effect of Periodontal Pathogens on the Metatranscriptome of a Healthy Multispecies Biofilm Model

doi: 10.1128/JB.06328-11

Figure Lengend Snippet: Bacterial strains and primers used in the study

Article Snippet: DNA was extracted as described above. table ft1 table-wrap mode="anchored" t5 caption a7 Bacterial strain or RT-qPCR primer Forward primer 5′–3′ Reverse primer 5′–3′ Target gene (source or reference) Bacterial strains Actinomyces naeslundii (MG1) GAGAAGAACTCCCTATCCATACC CTTCATGGGTTGGGATTTCCT Target is fimA gene, a fimbrial protein (this work) Fusobacterium nucleatum (ATCC10953) CTTATACATAGAGGACACAGAC TTTCCAACAACATCTCCCTG HprK gene ( 30 ) homologue of HPr kinase/phosphorylase (this work) Lactobacillus casei (ATCC 334) TGAATATTTACACGGTTCGGCA GGGCCTTAGTTTCATCCGAC Target is the phosphoglucomutase gene ( 10 ) (this work) Streptococcus mitis (NCTC 12261, ATCC 49456) CGTATCGGTCGTCTTGCT TTGCATAACTGGATCTGTAAGGTC Target is the glyceraldehyde-3-phosphate gene (this work) Veillonella parvula (ATCC17745) ACAGTTACTTTATAGTCTGTACC TGGTCAATTGGCTAAACGTCAA Target is the chaperone dnaK gene ( 29 ) (this work) Aggregatibacter actinomycetemcomitans (HK1651) ACGCAGACGATTGACTGAATTTAA GATCTTCACAGCTATATGGCAGCTA Target is lktC gene part of the leukotoxin operon lktBAC ( 54 ) Porphyromonas gingivalis (ATCC 33277) CCTACGTGTACGGACAGAGCTATA AGGATCGCTCAGCGTAGCATT Target is the Arg-gingipain gene ( 54 ) RT-qPCR primers Universal CGCTAGTAATCGTGGATCAGAATG TGTGACGGGCGGTGTGTA 16S rRNA ( 79 ) Actinomyces naeslundii (MG1) ATCTCCAAGGTTCTGCACGACGAGTA ATGTTGATGGTGATACCGCGCTGA ANA_0022 (this work) Aggregatibacter actinomycetemcomitans (HK1651) AAGAACTTAACGCTTGGGCGATGC TAACGCTTCTTGTGCAACACTGGC AA00470 (this work) Veillonella parvula (ATCC17745) AAAGCCTTGGGCCATTCTCTGTTG CCAAGGCCTCTTGTTCTTGCATCA HMPREF1035_1004 (this work) Porphyromonas gingivalis (ATCC 33277) AGAAAGCCAGCCATTGTTGCATGG TGTTCGGGACACCTGACTGTTCAT PGN_0074 (this work) Open in a separate window Bacterial strains and primers used in the study Doubling time was calculated using the following formula: t d = ( t 2 − t 1 ) × log (2)/log( q 2 / q 1 ), where q 2 represents the final number of cells, q 1 represents the initial number of cells added, and ( t 2 − t 1 ) represents the interval of incubation.

Techniques:

Bar chart of relative abundances of ASVs classified on genus level. Taxa with relative abundance of less than 1% were collectively summarized as ‘Other’. (A) Taxonomic composition of the slit lamp bacteriota from TC1 (Tertiary Center) and TC2 respectively and the respective sample sites (contact area – TC1: n = 28; ocular – TC1: n = 28; contact area - TC2: n = 14; ocular – TC2: n = 13). (B) Composition of mock taxa and controls (expected = expected mock abundances; mock = mock standard using Bact-0341f/Bact-0785r primers; blank = blank negative control).

Journal: Frontiers in Cellular and Infection Microbiology

Article Title: Comprehensive Compositional Analysis of the Slit Lamp Bacteriota

doi: 10.3389/fcimb.2021.745653

Figure Lengend Snippet: Bar chart of relative abundances of ASVs classified on genus level. Taxa with relative abundance of less than 1% were collectively summarized as ‘Other’. (A) Taxonomic composition of the slit lamp bacteriota from TC1 (Tertiary Center) and TC2 respectively and the respective sample sites (contact area – TC1: n = 28; ocular – TC1: n = 28; contact area - TC2: n = 14; ocular – TC2: n = 13). (B) Composition of mock taxa and controls (expected = expected mock abundances; mock = mock standard using Bact-0341f/Bact-0785r primers; blank = blank negative control).

Article Snippet: The mock community consisted of 6 typical skin bacterial species in equal total cell abundances ( Acinetobacter johnstonii ATCC 17090, Corynebacterium striatum ATCC 6940, Micrococcus luteus ATCC 4698, Cutibacterium acnes ATCC 11828, Staphylococcus epidermidis ATCC 12228 and Streptococcus mitis ATCC 49456, 16.7% each).

Techniques: Negative Control

A Strain of S. mitis inhibits S. mutans biofilm formation. ( A ) Representative image of a CV biofilm biomass assay where S. mutans is cocultured with different oral streptococci species (listed down right y -axis) in TYGS medium. S. mutans monoculture is shown at the top for reference. ( B ) CV quantification (Abs 575 nm) of the experiment shown in A. Data are expressed as the percentage of biomass formed in comparison to S. mutans monoculture (i.e., monoculture values set to 100%). B’ is same data on a smaller y -axis with S. cristatus and S. sobrinus coculture data removed. n = 6. ( C ) Merged representative maximum intensity 40× Z-projection of 24 h S . mutans monoculture biofilm (Mono). S. mutans constitutively expresses green fluorescent protein (GFP; green), eDNA was probed with labeled antibodies (yellow), and glucans were visualized with labeled dextran (red). Scale bar (100 µm) is shown in the bottom right corner. ( D ) Merged representative maximum intensity 40× Z-projection of 24 h S . mutans cocultured biofilm with S. mitis (+ S. mitis ). ( E ) Quantification of individual S. mutans microcolony volumes, ( F ) number of S. mutans microcolonies per field of view, ( G ) glucan biomass, and ( H ) eDNA biomass from the microscopy data shown in C and D. n = 4. Light gray bars represent S. mutans monoculture, and darker gray bars indicate coculture with S. mitis . Quantification was completed using Gen5 Image+ software. ( I ) S. mutans colony forming units (CFUs) returned from 24 h biofilms, with enumeration of cells in either biofilm (blue circles) or planktonic growth phase (green squares), grown with or without S. mitis . n = 4. ( J ) S. mitis CFUs returned. Data graphing and two-way analysis of variance with multiple comparisons or Student’s t -test were completed in GraphPad Prism software.

Journal: Applied and Environmental Microbiology

Article Title: A strain of Streptococcus mitis inhibits biofilm formation of caries pathogens via abundant hydrogen peroxide production

doi: 10.1128/aem.02192-24

Figure Lengend Snippet: A Strain of S. mitis inhibits S. mutans biofilm formation. ( A ) Representative image of a CV biofilm biomass assay where S. mutans is cocultured with different oral streptococci species (listed down right y -axis) in TYGS medium. S. mutans monoculture is shown at the top for reference. ( B ) CV quantification (Abs 575 nm) of the experiment shown in A. Data are expressed as the percentage of biomass formed in comparison to S. mutans monoculture (i.e., monoculture values set to 100%). B’ is same data on a smaller y -axis with S. cristatus and S. sobrinus coculture data removed. n = 6. ( C ) Merged representative maximum intensity 40× Z-projection of 24 h S . mutans monoculture biofilm (Mono). S. mutans constitutively expresses green fluorescent protein (GFP; green), eDNA was probed with labeled antibodies (yellow), and glucans were visualized with labeled dextran (red). Scale bar (100 µm) is shown in the bottom right corner. ( D ) Merged representative maximum intensity 40× Z-projection of 24 h S . mutans cocultured biofilm with S. mitis (+ S. mitis ). ( E ) Quantification of individual S. mutans microcolony volumes, ( F ) number of S. mutans microcolonies per field of view, ( G ) glucan biomass, and ( H ) eDNA biomass from the microscopy data shown in C and D. n = 4. Light gray bars represent S. mutans monoculture, and darker gray bars indicate coculture with S. mitis . Quantification was completed using Gen5 Image+ software. ( I ) S. mutans colony forming units (CFUs) returned from 24 h biofilms, with enumeration of cells in either biofilm (blue circles) or planktonic growth phase (green squares), grown with or without S. mitis . n = 4. ( J ) S. mitis CFUs returned. Data graphing and two-way analysis of variance with multiple comparisons or Student’s t -test were completed in GraphPad Prism software.

Article Snippet: During a recent study on how human saliva modifies the behavior of oral streptococci , we cocultured S. mutans with seven other oral streptococci ( S . sp. A12, Streptococcus cristatus ATCC 51100, Streptococcus gordonii DL1, Streptococcus mitis ATCC 49456, S. oralis 34, S. sanguinis SK36, and S. sobrinus 6715) both in broth culture and in biofilms containing human saliva.

Techniques: Comparison, Labeling, Microscopy, Software

S. mitis impacts biofilm formation of other oral streptococci. ( A ) Representative image of a CV biofilm biomass assay of different oral Streptococcus species listed on the left y -axis, grown in monoculture (Mono), in coculture with S. mitis (49456), or in coculture with the spxB mutant (Δ spxB ), in medium lacking (−) or containing (+) 100 U/mL catalase. ( B ) CV quantification (Abs 575 nm) of the experiment shown in A for strains S. cristatus 51100, S. oralis 34, and S. sobrinus 6715. Data are expressed as the percentage of biomass remaining in the S. mitis coculture condition compared to the monoculture condition (Mono), which lacks S. mitis . n = 6. Light gray bars represent monoculture, and darker gray bars indicated coculture with S. mitis . ( C ) Merged representative maximum intensity 40× Z-projection of 24 h S . cristatus , S. oralis , or S. sobrinus biofilms grown in monoculture (Mono), in coculture with S. mitis (49456), with the S. mitis spxB mutant (Δ spxB ), in medium lacking (−) or containing (+) 100 U/mL catalase. A total cell strain was applied to visualize cells within the biofilms (Hoechst 33342; blue), eDNA was probed with labeled antibodies (yellow), and glucans were visualized with labeled dextran (red). Scale bar (100 µm) is shown in the bottom right corner. ( D ) Quantification of total cell biomass within each biofilm in the various conditions. Quantification was completed using Gen5 Image+ software. Data graphing and two-way analysis of variance with multiple comparisons were completed in GraphPad Prism software.

Journal: Applied and Environmental Microbiology

Article Title: A strain of Streptococcus mitis inhibits biofilm formation of caries pathogens via abundant hydrogen peroxide production

doi: 10.1128/aem.02192-24

Figure Lengend Snippet: S. mitis impacts biofilm formation of other oral streptococci. ( A ) Representative image of a CV biofilm biomass assay of different oral Streptococcus species listed on the left y -axis, grown in monoculture (Mono), in coculture with S. mitis (49456), or in coculture with the spxB mutant (Δ spxB ), in medium lacking (−) or containing (+) 100 U/mL catalase. ( B ) CV quantification (Abs 575 nm) of the experiment shown in A for strains S. cristatus 51100, S. oralis 34, and S. sobrinus 6715. Data are expressed as the percentage of biomass remaining in the S. mitis coculture condition compared to the monoculture condition (Mono), which lacks S. mitis . n = 6. Light gray bars represent monoculture, and darker gray bars indicated coculture with S. mitis . ( C ) Merged representative maximum intensity 40× Z-projection of 24 h S . cristatus , S. oralis , or S. sobrinus biofilms grown in monoculture (Mono), in coculture with S. mitis (49456), with the S. mitis spxB mutant (Δ spxB ), in medium lacking (−) or containing (+) 100 U/mL catalase. A total cell strain was applied to visualize cells within the biofilms (Hoechst 33342; blue), eDNA was probed with labeled antibodies (yellow), and glucans were visualized with labeled dextran (red). Scale bar (100 µm) is shown in the bottom right corner. ( D ) Quantification of total cell biomass within each biofilm in the various conditions. Quantification was completed using Gen5 Image+ software. Data graphing and two-way analysis of variance with multiple comparisons were completed in GraphPad Prism software.

Article Snippet: During a recent study on how human saliva modifies the behavior of oral streptococci , we cocultured S. mutans with seven other oral streptococci ( S . sp. A12, Streptococcus cristatus ATCC 51100, Streptococcus gordonii DL1, Streptococcus mitis ATCC 49456, S. oralis 34, S. sanguinis SK36, and S. sobrinus 6715) both in broth culture and in biofilms containing human saliva.

Techniques: Mutagenesis, Labeling, Software